World Library  
Flag as Inappropriate
Email this Article

Haplogroup Q-M242

Article Id: WHEBN0004148860
Reproduction Date:

Title: Haplogroup Q-M242  
Author: World Heritage Encyclopedia
Language: English
Subject: Haplogroup E-V38, Haplogroup C-M130, Haplogroup O, Haplogroup H (Y-DNA), Haplogroup R (Y-DNA)
Collection: Human Y-Dna Haplogroups, Natural History of the Americas
Publisher: World Heritage Encyclopedia
Publication
Date:
 

Haplogroup Q-M242

Haplogroup Q

Possible time of origin 17,000 to 22,000 years ago[1][2]
Possible place of origin Central Asia,[3] the Indian Subcontinent,[4] Siberia[5]
Ancestor P
Descendants Q-P36.2 (P36.2)
Defining mutations M242
Highest frequencies Kets, Selkups, and indigenous peoples of the Americas

Haplogroup Q-M242 is a Y-chromosome DNA haplogroup.

Contents

  • Origins 1
  • Technical specification of mutation 2
  • Subclades 3
    • Phylogenetic trees 3.1
      • The Genomic Research Center Draft tree 3.1.1
      • The Y-Chromosome Consortium tree 3.1.2
      • The 2011 ISOGG tree 3.1.3
    • Phylogenetic variants 3.2
  • Distribution 4
    • The Americas 4.1
    • Asia 4.2
      • North Asia 4.2.1
      • East Asia 4.2.2
      • South Asia 4.2.3
      • Southwest Asia 4.2.4
    • Europe 4.3
    • Subclade distribution 4.4
  • aDNA 5
  • See also 6
    • Populations 6.1
    • Genetics 6.2
    • Y-DNA Q-M242 subclades 6.3
    • Y-DNA backbone tree 6.4
  • External links 7
  • References 8
    • Citations 8.1
    • Bibliography 8.2

Origins

Haplogroup Q-M242 is one of the two branches of haplogroup P-M45. Haplogroup Q-M242 is believed to have arisen in North Asia approximately 17,000 to 22,000 years ago.[6] It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of the M242, P36.2, and MEH2 SNPs as defining mutations.

This haplogroup has many diverse haplotypes. There also are over a dozen subclades that have been sampled and identified in modern populations.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The Genomic Research Center Draft tree

This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q-M242. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[7]

  • P
    • Q-M242 M242
      • P36.2, L232, L273.1, L274.1

The Y-Chromosome Consortium tree

This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008.[6] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[8] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • P-M45
    • Q-M242 M242
      • Q-P36.2 P36.2
        • Q-MEH2 MEH2 (Q1a)
            • Q-M120 M120, N14, M265 (Q1a1a1)
            • Q-M25 M25, M143 (Q1a1b)
          • Q-M346 L56, L57, M346 (Q1a2)
            • Q-P89.1 P89.1 (Unknown one singleton probably part of Q1a2)
        • Q-L275 L275 (Q1b)
          • Q-M378 L214, L215, M378 (Q1b1)

The 2011 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation(s), according to the 2011 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • Q M242
    • Q-P36.2 P36.2, L232, L273, L274
      • Q-MEH2 MEH2
        • Q-M120 M120, M265/N14
        • Q-M25 M25, M143
        • Q-M346 L56, L57, M346, L528
      • Q-L275 L275, L314
        • Q-M378 M378/Page100, L214, L215/Page82

Phylogenetic variants

The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STR DYS435 with a value of 8--> 9 [4] with in haplogroup Q M242 and the trend is to include only binary markers in phylogenetic trees. However, interestingly analysis of STR based haplotypes from Sharma 2007 indicates that the DYS435=9 variant, using online haplogroup prediction tool (like http://www.hprg.com , did not indicate an earlier established sub clade of Y-haplogroup Q.

Distribution

Haplogroup Q-M242 may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas, North Africa, East Asia, South Asia, West Asia, and in Europe.

The Americas

Several branches of haplogroup Q-M242 are part of the pre-Columbian male lineages in the predominant Y-chromosome haplogroup in indigenous peoples of the Americas. They were part of groups who migrated from Asia into the Americas by crossing the Bering Strait.[2] These small groups had few founders, but they must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In Canada, two other lineages have been found. These are Q-P89.1 and Q-NWT01. They may not be from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of shifts in a small founder population over time. However, Q-M242 came to dominate the paternal lineages in the Americas. Indeed, haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of South America[9] and detected in Na-Dené speakers at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.[10]

However, a 4000-year-old Saqqaq individual belonging to Q-MEH2 haplogroup has been documented.[11]

Asia

Q-M242 origininated in Asia, and is widely distributed there.[2] It has been reported that Q-M242 is found in the Altai people,[12] India,[13] Tibet,[14] Pakistan,[13] China,[15][16] Vietnam,[17] Mongolia,[18] Tuvans,[19] and Uyghurs.[18] It was found in 9 out of 49 specimens (18%) in a Y-Haplogroup study of Pashtuns in Kabul the Capital of Afghanistan.[20]

North Asia

To the east, haplogroup Q-M242 has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians.[12] It is found in 16% of Tuvans.[19]

The highest frequencies of Q-M242 in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia and their populations are small in number, being just under 5,000 and 1,500, respectively.

Q-M346 is found among the Khanty.[21]

East Asia

The frequency of Q-M242 in northern China is about 4%, with many Chinese samples of haplogroup Q-M242 belonging to the subclade Q-M120.[15][16] In a study published in 2011, researchers have reported finding haplogroup Q-M242 in 3.3% (12/361) of a sample of unrelated Han Chinese male volunteers at Fudan University in Shanghai with origins that can be traced back from all over China, though with a majority coming from East China.[22] Haplogroup Q-M242 is found in approximately 3% of males in Tibet[14] and Mongolia.[18] It is also found in 3% of Uyghurs.[18] Suclade Q1b-M378 exists troughout all Mongolia with examples in Japan.[23]

South Asia

Some examples of Q-M242 (negative for tested subclades) have been reported in the Indian subcontinent in low frequency.[4] The same studies have found Q-M346* (negative for known subclades) restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q-M242 to the Indian subcontinent followed by an autochthonous differentiation to Q-M346. However, these are from studies where all current branches of the Q-M242 tree have not been tested.

The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.

Southwest Asia

Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q-M242 in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q-M242 belong primarily to the subclade Q-M25.[24]

In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[25] or 3.4% (6/176).[26]

Approximately 2.5% of males in Saudi Arabia belong to haplogroup Q.[27]

According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q.[28] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.

Haplogroup Q-M242 has also been found in Algerians, Arabians, Syrians, Lebanese[29] and the United Arab Emirates.,[30]

Approximately 2% of males in Turkey belong to haplogroup Q.[31] In a study by Gokcumen it was found that among Turks that belong to the Afshar tribe haplogroup Q-M242 is seen with a prevalence of 13%.[32] Further, the Q-M25 subclade has been found in Turkey[31]

Europe

The frequency of haplogroup Q-M242 in Norway and Sweden is about 3%. It is believed that almost all of these are either Q-L527 or Q-L804. Around 2.5% of Slovak males are in haplogroup Q-M242.

Subclade distribution

  • Q (M242)
    • Q*Found with low frequency in India and Pakistan.[13] Important in Afghanistan, paragroup Q-M242 (xMEH2,xM378) was found at 16.3% in Pashtun people.[20]
    • Q-P36.2 (P36.2) Found with low frequency in Iran.[33]
      • Q-MEH2 (MEH2) Was found in Koryaks (at 10.3%), although the level of STR diversity associated with Q-MEH2 is very low, this lineage appears to be closest to the extinct Palaeo-Eskimo individuals belonging to the Saqqaq culture arisen in the New World Arctic about 5.5 Ka.[34]
      • Q-L275 (L275, L314)
        • Q-M378 (M378) — It is widely distributed in Europe, South Asia, West and East Asia. It is found among samples of Hazaras and Sindhis.[26] It is also found in the Mongols, the Japanese people and the Uyghurs of North-Western China in two separate groups.[43] The Q-M378 subclade and specifically its Q-L245 subbranch is speculated to be the branch to which Q-M242 men in Jewish Diaspora populations belong.[28][44] Although published articles have not tested for M378 in Jewish populations, genetic genealogists from the Ashkenazi, Mizrachi, and Sephardi Jewish populations have tested positive for both M378 and L245. Q-M378 samples also has been located in Central America (Panama) and South America (Andean Region)[45]

aDNA

The 12,6 thousand year old Clovis culture individual on the territory of Montana belonged to Q-L54*(xM3).[46][47]

Over the past decade, Chinese archaeologists have published several reviews regarding the results of excavations in Xinjiang. Particularly interesting are in the cemetery Heigouliang, Xinjiang (Black Gouliang cemetery), east of Barkol basin, near the city of Hami. By typing results of DNA samples during the excavation of one of the tombs it was determined that of the 12 men there were: Q1a - 6, Q1b(1) (M378) - 4, Q-2 (unable to determine subclade). Hosts of the tombs were representatives of Y-haplogroup Q1b(1)- M378 exclusively (while Y-DNA Q1a represents sacrificial victims). They date from the time of early (Western) Han (2-1 century BC). Summarizing the data from available evidences, it is concluded that the tomb belongs to the representatives of the Xiongnu/Hunnu aristocracy.[48][49][50]

See also

Populations

Genetics

Y-DNA Q-M242 subclades

Y-DNA backbone tree

Evolutionary tree of human Y-chromosome DNA (Y-DNA) haplogroups
  • Minimal reference phylogeny for the human Y chromosome (ver. 10-Jun-2014)PDF[n 1]
MRC Y-ancestor
A00 A0'1'2'3'4
A0 A1'2'3'4
A1 A2'3'4
A2'3 A4=BCDEF
A2 A3 B CDEF
DE CF
D E C F
GHIJKLT
G HIJKLT
H IJKLT
IJ KLT (K)
I J LT(K1) K (K2)
L T MPS (K2b) X (K2a)
MS P NO
M S QR N O
Q R
  1. ^ van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation 35 (2): 187–91.  

External links

References

Citations

  1. ^ Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics 82 (3): 583–592.  
  2. ^ a b c Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas". Molecular Biology and Evolution 21 (1): 164–75.  
  3. ^ Y-DNA Haplogroup Q and its Subclades - 2010
  4. ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7: 232.  
  5. ^ a b "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21. Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present 
  6. ^ a b Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–8.  
  7. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)".  
  8. ^ "Y-DNA Haplotree".  Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  9. ^ Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics 73 (3): 524–39.  
  10. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30. 
  11. ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762.  
  12. ^ a b V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  13. ^ a b c The Y Chromosome Consortium 2008
  14. ^ a b c d Gayden T, Cadenas AM, Regueiro M, et al. (May 2007). "The Himalayas as a Directional Barrier to Gene Flow". Am. J. Hum. Genet. 80 (5): 884–94.  
  15. ^ a b c Wen B, Li H, Lu D, et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature 431 (7006): 302–5.  
  16. ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics 107 (6): 582–90.  
  17. ^ a b Tatiana M. Karafet, Brian Hallmark, Murray P. Cox et al. (2010) "Major East–West Division Underlies Y Chromosome Stratification across Indonesia," Mol. Biol. Evol. 27(8) 1833–1844. doi:10.1093/molbev/msq063 PMID 20207712
  18. ^ a b c d Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics 51 (1): 47–58.  
  19. ^ a b Pakendorf, Brigitte, Novgorodov, Innokentij N., Osakovskij, Vladimir L., Danilova, Al’Bina P., Protod’Jakonov, Artur P., Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics 120 (3): 334–353.  
  20. ^ a b Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLoS ONE 7 (3): e34288.  
  21. ^ Mirabal S, Regueiro M, Cadenas AM, et al. (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73.  
  22. ^ Yan, Shi; Chuan-; Wang, Chao; Li, Hui et al. (2011). "An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4". European Journal of Human Genetics 19: 1013–1015.  
  23. ^ Y-chromosome lineage in five regional Mongolian populations Toshimichi Yamamotoemail, Tomoki Senda, Daiki Horiba, Masayoshi Sakuma, Yuuka Kawaguchi, Yuuichi Kano
  24. ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43.  
  25. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics 15 (1): 121–126.  
  26. ^ a b c d e Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A. et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics 78 (2): 202–221.  
  27. ^ a b Abu-Amero, Khaled K., Hellani, Ali, Gonzalez, Ana M., Larruga, Jose M, Cabrera, Vicente M, Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics 10: 59.  
  28. ^ a b http://www.springerlink.com/content/xvj2jwclptvrvmer/
  29. ^ Zalloua PA, Xue Y, Khalife J, et al. (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82.  
  30. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86.  
  31. ^ a b c Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48.  
  32. ^ Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania.  
  33. ^ Grugni, Viola et al.; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLoS ONE 7 (7): e41252.  
  34. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics 56 (8): 583–8.  
  35. ^ a b Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9.  
  36. ^ Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics 71 (4): 480–495.  
  37. ^ a b c d e f g Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLoS ONE 8 (10): e76748.  
  38. ^ Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y et al. (2014). "Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor". PLoS ONE 9 (8): e103772.  
  39. ^ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y et al.; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLoS ONE 6 (8): e24282.  
  40. ^ Zalloua, Pierre A., Xue, Y, Khalife, J, Makhoul, N, Debiane, L, Platt, DE, Royyuru, AK, Herrera, RJ et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics 82 (4): 873–882.  
  41. ^ Bortolini MC, Salzano FM, Thomas MG, et al. (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". Am. J. Hum. Genet. 73 (3): 524–39.  
  42. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation 24 (3): 248–60.   Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  43. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution 28 (1): 717–27.  
  44. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M. et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet 83 (6): 725–736.  
  45. ^ The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q Vincenza Battaglia, Viola Grugni, Ugo Alessandro Perego, Norman Angerhofer, J. Edgar Gomez-Palmieri, Scott Ray Woodward, Alessandro Achilli, Natalie Myres, Antonio Torroni, Ornella Semino
  46. ^ M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.
  47. ^ Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  48. ^ Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families. LL. Kang et al., 2013
  49. ^ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  50. ^ Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Li Hongjie, Jilin University-China, 2012

Bibliography

  • Abu-Amero, Khaled K; Hellani, Ali; González, Ana M; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics 10: 59.  
  • Behar, Doron M.; Garrigan, Daniel; Kaplan, Matthew E.; Mobasher, Zahra; Rosengarten, Dror; Karafet, Tatiana M.; Quintana-Murci, Lluis; Ostrer, Harry et al. (2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Human Genetics 114 (4): 354–65.  
  • Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics 73 (3): 524–39.  
  • Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007). "Y-chromosome diversity characterizes the Gulf of Oman". European Journal of Human Genetics 16 (3): 374–86.  
  • Cinnioglu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoglu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C. et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114 (2): 127–48.  
  • Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2006). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics 15 (1): 121–6.  
  • Gayden, T; Cadenas, AM; Regueiro, M; Singh, NB; Zhivotovsky, LA; Underhill, PA; Cavalli-Sforza, LL; Herrera, RJ (2007). "The Himalayas as a Directional Barrier to Gene Flow". The American Journal of Human Genetics 80 (5): 884–94.  
  • Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese* common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics 51 (1): 47–58.  
  • Mirabal, Sheyla; Regueiro, Maria; Cadenas, Alicia M; Cavalli-Sforza, L Luca; Underhill, Peter A; Verbenko, Dmitry A; Limborska, Svetlana A; Herrera, Rene J (2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". European Journal of Human Genetics 17 (10): 1260–73.  
  • Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics 71 (Pt 4): 480–95.  
  • Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia* genetic variation and the origins of Yakuts". Human Genetics 120 (3): 334–53.  
  • Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene et al. (2010). "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature 463 (7282): 757–62.  
  • Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). "Iran* Tricontinental Nexus for Y-Chromosome Driven Migration". Human Heredity 61 (3): 132–43.  
  • Sengupta, S; Zhivotovsky, L; King, R; Mehdi, S; Edmonds, C; Chow, C; Lin, A; Mitra, M et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics 78 (2): 202–21.  
  • Sharma, Swarkar; Rai, Ekta; Bhat, Audesh K; Bhanwer, Amarjit S; Bamezai, Rameshwar NK (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evolutionary Biology 7: 232.  
  • Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation 24 (3): 248–60.  
  • Wells, Spencer. The Journey of Man* A Genetic Odyssey (Digitised online by Google books). Random House.  
  • Wells, R. S.; Yuldasheva, N; Ruzibakiev, R; Underhill, PA; Evseeva, I; Blue-Smith, J; Jin, L; Su, B et al. (2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proceedings of the National Academy of Sciences 98 (18): 10244–9.  
  • Wen, Bo; Li, Hui; Lu, Daru; Song, Xiufeng; Zhang, Feng; He, Yungang; Li, Feng; Gao, Yang et al. (2004). "Genetic evidence supports demic diffusion of Han culture". Nature 431 (7006): 302–5.  
  • Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics 107 (6): 582–90.  
  • Zalloua, P; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, D; Royyuru, A; Herrera, R et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". The American Journal of Human Genetics 82 (4): 873–82.  
  • Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas". Molecular Biology and Evolution 21 (1): 164–75.  
  • Wells, Spencer (2002). The Journey of Man: A Genetic Odyssey. Random House LLC.  
  • Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania.  
This article was sourced from Creative Commons Attribution-ShareAlike License; additional terms may apply. World Heritage Encyclopedia content is assembled from numerous content providers, Open Access Publishing, and in compliance with The Fair Access to Science and Technology Research Act (FASTR), Wikimedia Foundation, Inc., Public Library of Science, The Encyclopedia of Life, Open Book Publishers (OBP), PubMed, U.S. National Library of Medicine, National Center for Biotechnology Information, U.S. National Library of Medicine, National Institutes of Health (NIH), U.S. Department of Health & Human Services, and USA.gov, which sources content from all federal, state, local, tribal, and territorial government publication portals (.gov, .mil, .edu). Funding for USA.gov and content contributors is made possible from the U.S. Congress, E-Government Act of 2002.
 
Crowd sourced content that is contributed to World Heritage Encyclopedia is peer reviewed and edited by our editorial staff to ensure quality scholarly research articles.
 
By using this site, you agree to the Terms of Use and Privacy Policy. World Heritage Encyclopedia™ is a registered trademark of the World Public Library Association, a non-profit organization.
 


Copyright © World Library Foundation. All rights reserved. eBooks from Project Gutenberg are sponsored by the World Library Foundation,
a 501c(4) Member's Support Non-Profit Organization, and is NOT affiliated with any governmental agency or department.